Review



sequence scrambled sirna negative control  (Santa Cruz Biotechnology)


Bioz Verified Symbol Santa Cruz Biotechnology is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Santa Cruz Biotechnology sequence scrambled sirna negative control
    Hydroxyapatite induced cytosolic CTSB contributed to NLRP3 inflammasome activation and caused chondrocyte pyroptosis. A) The Western blot result and quantitative analysis of Cathepsin B (CTSB) protein level of chondrocytes <t>after</t> <t>transfected</t> with <t>siRNA</t> targeting CTSB (si-CTSB). B) NLRP3, Caspase1 p20 and N-GSDMD protein levels of chondrocytes after the designated treatment, as determined by Western blot. C) Immunofluorescence staining of CTSB protein in chondrocytes of different groups. Scale bar: 10 μm. D) Fluorescence co-staining of propidium iodide (PI) and Hoechst 33342 in chondrocytes of different groups. Scale bar: 100 μm. E) Quantitative analysis of the fluorescence intensity of CTSB protein in (C) (n = 3). F–H) Quantitative analysis of NLRP3, Caspase1 p20 and N-GSDMD protein levels in (B) (n = 3). I-J) Quantitative analysis of IL-1β and lactate dehydrogenase (LDH) levels in chondrocyte culture supernatants of different groups (n = 3). K) Quantitative analysis of the percentage of PI-positive chondrocytes in (D) (n = 3). L) Cytosolic CTSB protein level and total NLRP3, Caspase1 p20, N-GSDMD, collagen II and aggrecan protein levels of chondrocytes after the designated treatment, as determined by Western blot. M) Fluorescence co-staining of PI and Hoechst 33342 in chondrocytes of different groups. Scale bar: 100 μm. N ) Schematic depicting the mechanism whereby hydroxyapatite (HAp) triggered chondrocyte pyroptosis. Statistical analyses were performed using one-way ANOVA with Holm-Šidák multiple comparison tests. NS, no significance; *, P < 0.05; **, P < 0.01; ***, P < 0.001.
    Sequence Scrambled Sirna Negative Control, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 6130 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sequence scrambled sirna negative control/product/Santa Cruz Biotechnology
    Average 96 stars, based on 6130 article reviews
    sequence scrambled sirna negative control - by Bioz Stars, 2026-03
    96/100 stars

    Images

    1) Product Images from "Lysosomal destabilization: A missing link between pathological calcification and osteoarthritis"

    Article Title: Lysosomal destabilization: A missing link between pathological calcification and osteoarthritis

    Journal: Bioactive Materials

    doi: 10.1016/j.bioactmat.2023.12.001

    Hydroxyapatite induced cytosolic CTSB contributed to NLRP3 inflammasome activation and caused chondrocyte pyroptosis. A) The Western blot result and quantitative analysis of Cathepsin B (CTSB) protein level of chondrocytes after transfected with siRNA targeting CTSB (si-CTSB). B) NLRP3, Caspase1 p20 and N-GSDMD protein levels of chondrocytes after the designated treatment, as determined by Western blot. C) Immunofluorescence staining of CTSB protein in chondrocytes of different groups. Scale bar: 10 μm. D) Fluorescence co-staining of propidium iodide (PI) and Hoechst 33342 in chondrocytes of different groups. Scale bar: 100 μm. E) Quantitative analysis of the fluorescence intensity of CTSB protein in (C) (n = 3). F–H) Quantitative analysis of NLRP3, Caspase1 p20 and N-GSDMD protein levels in (B) (n = 3). I-J) Quantitative analysis of IL-1β and lactate dehydrogenase (LDH) levels in chondrocyte culture supernatants of different groups (n = 3). K) Quantitative analysis of the percentage of PI-positive chondrocytes in (D) (n = 3). L) Cytosolic CTSB protein level and total NLRP3, Caspase1 p20, N-GSDMD, collagen II and aggrecan protein levels of chondrocytes after the designated treatment, as determined by Western blot. M) Fluorescence co-staining of PI and Hoechst 33342 in chondrocytes of different groups. Scale bar: 100 μm. N ) Schematic depicting the mechanism whereby hydroxyapatite (HAp) triggered chondrocyte pyroptosis. Statistical analyses were performed using one-way ANOVA with Holm-Šidák multiple comparison tests. NS, no significance; *, P < 0.05; **, P < 0.01; ***, P < 0.001.
    Figure Legend Snippet: Hydroxyapatite induced cytosolic CTSB contributed to NLRP3 inflammasome activation and caused chondrocyte pyroptosis. A) The Western blot result and quantitative analysis of Cathepsin B (CTSB) protein level of chondrocytes after transfected with siRNA targeting CTSB (si-CTSB). B) NLRP3, Caspase1 p20 and N-GSDMD protein levels of chondrocytes after the designated treatment, as determined by Western blot. C) Immunofluorescence staining of CTSB protein in chondrocytes of different groups. Scale bar: 10 μm. D) Fluorescence co-staining of propidium iodide (PI) and Hoechst 33342 in chondrocytes of different groups. Scale bar: 100 μm. E) Quantitative analysis of the fluorescence intensity of CTSB protein in (C) (n = 3). F–H) Quantitative analysis of NLRP3, Caspase1 p20 and N-GSDMD protein levels in (B) (n = 3). I-J) Quantitative analysis of IL-1β and lactate dehydrogenase (LDH) levels in chondrocyte culture supernatants of different groups (n = 3). K) Quantitative analysis of the percentage of PI-positive chondrocytes in (D) (n = 3). L) Cytosolic CTSB protein level and total NLRP3, Caspase1 p20, N-GSDMD, collagen II and aggrecan protein levels of chondrocytes after the designated treatment, as determined by Western blot. M) Fluorescence co-staining of PI and Hoechst 33342 in chondrocytes of different groups. Scale bar: 100 μm. N ) Schematic depicting the mechanism whereby hydroxyapatite (HAp) triggered chondrocyte pyroptosis. Statistical analyses were performed using one-way ANOVA with Holm-Šidák multiple comparison tests. NS, no significance; *, P < 0.05; **, P < 0.01; ***, P < 0.001.

    Techniques Used: Activation Assay, Western Blot, Transfection, Immunofluorescence, Staining, Fluorescence, Comparison



    Similar Products

    90
    Sangon Biotech negative control sirna with scramble sequence
    Negative Control Sirna With Scramble Sequence, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control sirna with scramble sequence/product/Sangon Biotech
    Average 90 stars, based on 1 article reviews
    negative control sirna with scramble sequence - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher scrambled negative control sirna sequence
    <t>TTN-AS1-276</t> regulates inclusion of I-band exons in TTN . ( A ) Per cent spliced in (PSI) for all exons across the TTN gene calculated based on RNA-sequencing reads from human iPS-derived cardiomyocytes (IPS-CM). The line represents the mean of three replicates (individual RNA preparations) per experimental group. ( B ) The difference in PSI (ΔPSI) comparing cells transfected with <t>siRNA</t> to TTN-AS1-276 (si276-Ex1) with cells transfected with scrambled negative control siRNA (siScr). Exons with statistically significant ΔPSI are marked with red bars (adjusted P < 0.05). ( C ) Depiction of exon skipping from TTN exon 49. ( D ) Quantification of TTN splice products in iPS-CM transfected with si276-Ex1, si276-Ex12, siRBM20 or siScr, using custom qRT–PCR assays spanning the indicated exon–exon junctions. Expression data are normalized to that of total TTN and expressed relative to the mean of the negative control cells (siScr). Data are derived from two separate experiments with 3–6 replicates (individual RNA preparations) per experimental group. Differences between each individual experimental group and the control group were assessed with Student’s t -tests, * P < 0.05, ** P < 0.01, *** P < 0.001.
    Scrambled Negative Control Sirna Sequence, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/scrambled negative control sirna sequence/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    scrambled negative control sirna sequence - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    90
    Shanghai GenePharma negative control sirnas with scramble sequence
    <t>TTN-AS1-276</t> regulates inclusion of I-band exons in TTN . ( A ) Per cent spliced in (PSI) for all exons across the TTN gene calculated based on RNA-sequencing reads from human iPS-derived cardiomyocytes (IPS-CM). The line represents the mean of three replicates (individual RNA preparations) per experimental group. ( B ) The difference in PSI (ΔPSI) comparing cells transfected with <t>siRNA</t> to TTN-AS1-276 (si276-Ex1) with cells transfected with scrambled negative control siRNA (siScr). Exons with statistically significant ΔPSI are marked with red bars (adjusted P < 0.05). ( C ) Depiction of exon skipping from TTN exon 49. ( D ) Quantification of TTN splice products in iPS-CM transfected with si276-Ex1, si276-Ex12, siRBM20 or siScr, using custom qRT–PCR assays spanning the indicated exon–exon junctions. Expression data are normalized to that of total TTN and expressed relative to the mean of the negative control cells (siScr). Data are derived from two separate experiments with 3–6 replicates (individual RNA preparations) per experimental group. Differences between each individual experimental group and the control group were assessed with Student’s t -tests, * P < 0.05, ** P < 0.01, *** P < 0.001.
    Negative Control Sirnas With Scramble Sequence, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control sirnas with scramble sequence/product/Shanghai GenePharma
    Average 90 stars, based on 1 article reviews
    negative control sirnas with scramble sequence - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    90
    Sangon Biotech negative control sirna with a scrambled sequence sinc
    <t>TTN-AS1-276</t> regulates inclusion of I-band exons in TTN . ( A ) Per cent spliced in (PSI) for all exons across the TTN gene calculated based on RNA-sequencing reads from human iPS-derived cardiomyocytes (IPS-CM). The line represents the mean of three replicates (individual RNA preparations) per experimental group. ( B ) The difference in PSI (ΔPSI) comparing cells transfected with <t>siRNA</t> to TTN-AS1-276 (si276-Ex1) with cells transfected with scrambled negative control siRNA (siScr). Exons with statistically significant ΔPSI are marked with red bars (adjusted P < 0.05). ( C ) Depiction of exon skipping from TTN exon 49. ( D ) Quantification of TTN splice products in iPS-CM transfected with si276-Ex1, si276-Ex12, siRBM20 or siScr, using custom qRT–PCR assays spanning the indicated exon–exon junctions. Expression data are normalized to that of total TTN and expressed relative to the mean of the negative control cells (siScr). Data are derived from two separate experiments with 3–6 replicates (individual RNA preparations) per experimental group. Differences between each individual experimental group and the control group were assessed with Student’s t -tests, * P < 0.05, ** P < 0.01, *** P < 0.001.
    Negative Control Sirna With A Scrambled Sequence Sinc, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control sirna with a scrambled sequence sinc/product/Sangon Biotech
    Average 90 stars, based on 1 article reviews
    negative control sirna with a scrambled sequence sinc - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher scrambled sequence sirna as a negative control
    Downregulation of KAT6A/B mRNAs and protein expression by <t>siRNA-induced</t> knock-down in breast cancer cell lines MCF-7 and MDA-MB-231. Quantitative polymerase chain reaction was used to analyze KAT6A, KAT6B and ERα mRNA expression in MCF-7 cell line ( A ) and KAT6A and KAT6B in MDA-MB-231 cell line ( B ). Western blot analysis ( F ) measured the effects of siRNA-mediated knockdown of KAT6A, KAT6B and ER in MCF-7 ( C ) and KAT6A/B in MDA-MB-231 ( D ) cell <t>lines.</t> <t>GAPDH</t> was used as an internal control ( E ). Data represent the mean and standard deviation of three independent experiments. Comparisons between groups were done using Student’s t-test: * p < 0.1; ** p < 0.01; *** p < 0.001; **** p < 0.0001. Source data are provided as a Supplementary S1.
    Scrambled Sequence Sirna As A Negative Control, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/scrambled sequence sirna as a negative control/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    scrambled sequence sirna as a negative control - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    90
    Shanghai GenePharma negative control sirna scrambled sequence (siscr
    Downregulation of KAT6A/B mRNAs and protein expression by <t>siRNA-induced</t> knock-down in breast cancer cell lines MCF-7 and MDA-MB-231. Quantitative polymerase chain reaction was used to analyze KAT6A, KAT6B and ERα mRNA expression in MCF-7 cell line ( A ) and KAT6A and KAT6B in MDA-MB-231 cell line ( B ). Western blot analysis ( F ) measured the effects of siRNA-mediated knockdown of KAT6A, KAT6B and ER in MCF-7 ( C ) and KAT6A/B in MDA-MB-231 ( D ) cell <t>lines.</t> <t>GAPDH</t> was used as an internal control ( E ). Data represent the mean and standard deviation of three independent experiments. Comparisons between groups were done using Student’s t-test: * p < 0.1; ** p < 0.01; *** p < 0.001; **** p < 0.0001. Source data are provided as a Supplementary S1.
    Negative Control Sirna Scrambled Sequence (Siscr, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control sirna scrambled sequence (siscr/product/Shanghai GenePharma
    Average 90 stars, based on 1 article reviews
    negative control sirna scrambled sequence (siscr - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    96
    OriGene lentivirus negative scramble shrna target sequence gcactaccagagctaactcagatagtact

    Lentivirus Negative Scramble Shrna Target Sequence Gcactaccagagctaactcagatagtact, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentivirus negative scramble shrna target sequence gcactaccagagctaactcagatagtact/product/OriGene
    Average 96 stars, based on 1 article reviews
    lentivirus negative scramble shrna target sequence gcactaccagagctaactcagatagtact - by Bioz Stars, 2026-03
    96/100 stars
      Buy from Supplier

    90
    Shanghai GenePharma sirnas specific for human sod2 and negative control sirna with scrambled sequences

    Sirnas Specific For Human Sod2 And Negative Control Sirna With Scrambled Sequences, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sirnas specific for human sod2 and negative control sirna with scrambled sequences/product/Shanghai GenePharma
    Average 90 stars, based on 1 article reviews
    sirnas specific for human sod2 and negative control sirna with scrambled sequences - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    96
    Santa Cruz Biotechnology sequence scrambled sirna negative control
    Hydroxyapatite induced cytosolic CTSB contributed to NLRP3 inflammasome activation and caused chondrocyte pyroptosis. A) The Western blot result and quantitative analysis of Cathepsin B (CTSB) protein level of chondrocytes <t>after</t> <t>transfected</t> with <t>siRNA</t> targeting CTSB (si-CTSB). B) NLRP3, Caspase1 p20 and N-GSDMD protein levels of chondrocytes after the designated treatment, as determined by Western blot. C) Immunofluorescence staining of CTSB protein in chondrocytes of different groups. Scale bar: 10 μm. D) Fluorescence co-staining of propidium iodide (PI) and Hoechst 33342 in chondrocytes of different groups. Scale bar: 100 μm. E) Quantitative analysis of the fluorescence intensity of CTSB protein in (C) (n = 3). F–H) Quantitative analysis of NLRP3, Caspase1 p20 and N-GSDMD protein levels in (B) (n = 3). I-J) Quantitative analysis of IL-1β and lactate dehydrogenase (LDH) levels in chondrocyte culture supernatants of different groups (n = 3). K) Quantitative analysis of the percentage of PI-positive chondrocytes in (D) (n = 3). L) Cytosolic CTSB protein level and total NLRP3, Caspase1 p20, N-GSDMD, collagen II and aggrecan protein levels of chondrocytes after the designated treatment, as determined by Western blot. M) Fluorescence co-staining of PI and Hoechst 33342 in chondrocytes of different groups. Scale bar: 100 μm. N ) Schematic depicting the mechanism whereby hydroxyapatite (HAp) triggered chondrocyte pyroptosis. Statistical analyses were performed using one-way ANOVA with Holm-Šidák multiple comparison tests. NS, no significance; *, P < 0.05; **, P < 0.01; ***, P < 0.001.
    Sequence Scrambled Sirna Negative Control, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sequence scrambled sirna negative control/product/Santa Cruz Biotechnology
    Average 96 stars, based on 1 article reviews
    sequence scrambled sirna negative control - by Bioz Stars, 2026-03
    96/100 stars
      Buy from Supplier

    90
    Sangon Biotech scrambled negative control (nc) sirna with cd54 analog nonsense sequences
    Hydroxyapatite induced cytosolic CTSB contributed to NLRP3 inflammasome activation and caused chondrocyte pyroptosis. A) The Western blot result and quantitative analysis of Cathepsin B (CTSB) protein level of chondrocytes <t>after</t> <t>transfected</t> with <t>siRNA</t> targeting CTSB (si-CTSB). B) NLRP3, Caspase1 p20 and N-GSDMD protein levels of chondrocytes after the designated treatment, as determined by Western blot. C) Immunofluorescence staining of CTSB protein in chondrocytes of different groups. Scale bar: 10 μm. D) Fluorescence co-staining of propidium iodide (PI) and Hoechst 33342 in chondrocytes of different groups. Scale bar: 100 μm. E) Quantitative analysis of the fluorescence intensity of CTSB protein in (C) (n = 3). F–H) Quantitative analysis of NLRP3, Caspase1 p20 and N-GSDMD protein levels in (B) (n = 3). I-J) Quantitative analysis of IL-1β and lactate dehydrogenase (LDH) levels in chondrocyte culture supernatants of different groups (n = 3). K) Quantitative analysis of the percentage of PI-positive chondrocytes in (D) (n = 3). L) Cytosolic CTSB protein level and total NLRP3, Caspase1 p20, N-GSDMD, collagen II and aggrecan protein levels of chondrocytes after the designated treatment, as determined by Western blot. M) Fluorescence co-staining of PI and Hoechst 33342 in chondrocytes of different groups. Scale bar: 100 μm. N ) Schematic depicting the mechanism whereby hydroxyapatite (HAp) triggered chondrocyte pyroptosis. Statistical analyses were performed using one-way ANOVA with Holm-Šidák multiple comparison tests. NS, no significance; *, P < 0.05; **, P < 0.01; ***, P < 0.001.
    Scrambled Negative Control (Nc) Sirna With Cd54 Analog Nonsense Sequences, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/scrambled negative control (nc) sirna with cd54 analog nonsense sequences/product/Sangon Biotech
    Average 90 stars, based on 1 article reviews
    scrambled negative control (nc) sirna with cd54 analog nonsense sequences - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    Image Search Results


    TTN-AS1-276 regulates inclusion of I-band exons in TTN . ( A ) Per cent spliced in (PSI) for all exons across the TTN gene calculated based on RNA-sequencing reads from human iPS-derived cardiomyocytes (IPS-CM). The line represents the mean of three replicates (individual RNA preparations) per experimental group. ( B ) The difference in PSI (ΔPSI) comparing cells transfected with siRNA to TTN-AS1-276 (si276-Ex1) with cells transfected with scrambled negative control siRNA (siScr). Exons with statistically significant ΔPSI are marked with red bars (adjusted P < 0.05). ( C ) Depiction of exon skipping from TTN exon 49. ( D ) Quantification of TTN splice products in iPS-CM transfected with si276-Ex1, si276-Ex12, siRBM20 or siScr, using custom qRT–PCR assays spanning the indicated exon–exon junctions. Expression data are normalized to that of total TTN and expressed relative to the mean of the negative control cells (siScr). Data are derived from two separate experiments with 3–6 replicates (individual RNA preparations) per experimental group. Differences between each individual experimental group and the control group were assessed with Student’s t -tests, * P < 0.05, ** P < 0.01, *** P < 0.001.

    Journal: Cardiovascular Research

    Article Title: Antisense-mediated regulation of exon usage in the elastic spring region of Titin modulates sarcomere function

    doi: 10.1093/cvr/cvaf037

    Figure Lengend Snippet: TTN-AS1-276 regulates inclusion of I-band exons in TTN . ( A ) Per cent spliced in (PSI) for all exons across the TTN gene calculated based on RNA-sequencing reads from human iPS-derived cardiomyocytes (IPS-CM). The line represents the mean of three replicates (individual RNA preparations) per experimental group. ( B ) The difference in PSI (ΔPSI) comparing cells transfected with siRNA to TTN-AS1-276 (si276-Ex1) with cells transfected with scrambled negative control siRNA (siScr). Exons with statistically significant ΔPSI are marked with red bars (adjusted P < 0.05). ( C ) Depiction of exon skipping from TTN exon 49. ( D ) Quantification of TTN splice products in iPS-CM transfected with si276-Ex1, si276-Ex12, siRBM20 or siScr, using custom qRT–PCR assays spanning the indicated exon–exon junctions. Expression data are normalized to that of total TTN and expressed relative to the mean of the negative control cells (siScr). Data are derived from two separate experiments with 3–6 replicates (individual RNA preparations) per experimental group. Differences between each individual experimental group and the control group were assessed with Student’s t -tests, * P < 0.05, ** P < 0.01, *** P < 0.001.

    Article Snippet: For knockdown experiments, cells were transfected with Silencer Select siRNA (ThermoFisher) directed towards exon 1 (si276-Ex1, #n294437) or exon 12 (si276-Ex12, custom design ID #ABRSBMG) of TTN-AS1-276, towards RBM20 (ENST00000369519.4, #s49081) or with a scrambled negative control siRNA sequence (#4390843).

    Techniques: RNA Sequencing, Derivative Assay, Transfection, Negative Control, Quantitative RT-PCR, Expressing, Control

    TTN-AS1-276 facilitates interaction between RBM20 and TTN mRNA. ( A – C ) Human iPS-derived cardiomyocytes (iPS-CM) were subjected to combined RNA in situ hybridization (ISH) for TTN-AS1-276 (magenta) and TTN (orange) and immunofluorescence for RBM20 (green) following transfection with siRNA towards TTN-AS1-276 (si276-Ex1), RBM20 (siRBM20), or scrambled negative control siRNA (siScr). Nuclei were counterstained with DAPI. Co-localization of TTN and RBM20 foci was analysed with high content imaging. ( D ) Depiction of experimental design for the RBM20 RNA immunoprecipitation (RIP) experiment. iPS-CM was transfected with a plasmid expressing a RBM20-GFP fusion protein. RIP was performed on iPS-CM protein using a GFP antibody and qRT–PCR was used to analyse immunoprecipitated RNA. ( E ) Enrichment of TTN and TTN-AS1-276 in GFP-RBM20 RIP RNA from iPS-CM transfected with si276-Ex1 or siScr, analysed with qRT–PCR. Analysis of unrelated GAPDH RNA was included as a negative control. Data are derived from two separate experiments with two technical replicates (individual immunoprecipitates) in each group * P < 0.05, ** P < 0.01. ( F ) The number of TCTT motifs/60 bp across intron 49 of TTN . The positions of RIP-qPCR assays used in ( G ) are indicated with dashed lines. ( G ) qPCR of GFP-RBM20 RIP RNA from ( E ) using assays targeting regions in intron 49 without TCTT motifs (‘In49 5p’) and enriched with TCTT motifs (‘In49 TCTT’). Data are derived from two separate experiments with two technical replicates (individual immunoprecipitates) in each group. Differences in the RIP signal between cells transfected within and between groups were assessed using ANOVA with Dunnett’s multiple comparisons test, * P < 0.05, ** P < 0.01.

    Journal: Cardiovascular Research

    Article Title: Antisense-mediated regulation of exon usage in the elastic spring region of Titin modulates sarcomere function

    doi: 10.1093/cvr/cvaf037

    Figure Lengend Snippet: TTN-AS1-276 facilitates interaction between RBM20 and TTN mRNA. ( A – C ) Human iPS-derived cardiomyocytes (iPS-CM) were subjected to combined RNA in situ hybridization (ISH) for TTN-AS1-276 (magenta) and TTN (orange) and immunofluorescence for RBM20 (green) following transfection with siRNA towards TTN-AS1-276 (si276-Ex1), RBM20 (siRBM20), or scrambled negative control siRNA (siScr). Nuclei were counterstained with DAPI. Co-localization of TTN and RBM20 foci was analysed with high content imaging. ( D ) Depiction of experimental design for the RBM20 RNA immunoprecipitation (RIP) experiment. iPS-CM was transfected with a plasmid expressing a RBM20-GFP fusion protein. RIP was performed on iPS-CM protein using a GFP antibody and qRT–PCR was used to analyse immunoprecipitated RNA. ( E ) Enrichment of TTN and TTN-AS1-276 in GFP-RBM20 RIP RNA from iPS-CM transfected with si276-Ex1 or siScr, analysed with qRT–PCR. Analysis of unrelated GAPDH RNA was included as a negative control. Data are derived from two separate experiments with two technical replicates (individual immunoprecipitates) in each group * P < 0.05, ** P < 0.01. ( F ) The number of TCTT motifs/60 bp across intron 49 of TTN . The positions of RIP-qPCR assays used in ( G ) are indicated with dashed lines. ( G ) qPCR of GFP-RBM20 RIP RNA from ( E ) using assays targeting regions in intron 49 without TCTT motifs (‘In49 5p’) and enriched with TCTT motifs (‘In49 TCTT’). Data are derived from two separate experiments with two technical replicates (individual immunoprecipitates) in each group. Differences in the RIP signal between cells transfected within and between groups were assessed using ANOVA with Dunnett’s multiple comparisons test, * P < 0.05, ** P < 0.01.

    Article Snippet: For knockdown experiments, cells were transfected with Silencer Select siRNA (ThermoFisher) directed towards exon 1 (si276-Ex1, #n294437) or exon 12 (si276-Ex12, custom design ID #ABRSBMG) of TTN-AS1-276, towards RBM20 (ENST00000369519.4, #s49081) or with a scrambled negative control siRNA sequence (#4390843).

    Techniques: Derivative Assay, RNA In Situ Hybridization, Immunofluorescence, Transfection, Negative Control, Imaging, RNA Immunoprecipitation, Plasmid Preparation, Expressing, Quantitative RT-PCR, Immunoprecipitation

    TTN-AS1-276 facilitates splicing of additional RBM20 targets. ( A – C ) Difference in PSI (ΔPSI) comparing cells transfected with siRNA to TTN-AS1-276 (si276-Ex1, blue) or RBM20 (siRBM20, red) with cells transfected with scrambled negative control siRNA (siScr) across all exons of the ( A ) CACNA1C , ( B ) LMO7 , and ( C ) CAMK2D genes in human iPS-derived cardiomyocytes (iPS-CM). The lines represent the mean of three technical replicates (individual RNA preparations). ( D – F ) Relative expression of alternative splice products of the ( D ) CACNA1C , ( E ) LMO7 , and ( F ) CAMK2D genes in iPS-CM transfected with siRBM20, si276-Ex1 or siScr and analysed with qRT–PCR ( CACNA1C and LMO7 ) and semi-quantitative RT–PCR ( CAMK2D ), respectively. Data are derived from three separate experiments with three technical replicates (individual RNA preparations) in each group. Differences between each individual experimental group and the control group were assessed with Student’s t -tests, * P < 0.05, ** P < 0.01, *** P < 0.001. ( G ) Enrichment of CACNA1C , LMO7 , and CAMK2D in GFP-RBM20 RIP RNA from iPS-CM transfected with si276-Ex1 or siScr, analysed with qRT–PCR. Analysis of unrelated GAPDH RNA was included as a negative control. Data are derived from two separate experiments.

    Journal: Cardiovascular Research

    Article Title: Antisense-mediated regulation of exon usage in the elastic spring region of Titin modulates sarcomere function

    doi: 10.1093/cvr/cvaf037

    Figure Lengend Snippet: TTN-AS1-276 facilitates splicing of additional RBM20 targets. ( A – C ) Difference in PSI (ΔPSI) comparing cells transfected with siRNA to TTN-AS1-276 (si276-Ex1, blue) or RBM20 (siRBM20, red) with cells transfected with scrambled negative control siRNA (siScr) across all exons of the ( A ) CACNA1C , ( B ) LMO7 , and ( C ) CAMK2D genes in human iPS-derived cardiomyocytes (iPS-CM). The lines represent the mean of three technical replicates (individual RNA preparations). ( D – F ) Relative expression of alternative splice products of the ( D ) CACNA1C , ( E ) LMO7 , and ( F ) CAMK2D genes in iPS-CM transfected with siRBM20, si276-Ex1 or siScr and analysed with qRT–PCR ( CACNA1C and LMO7 ) and semi-quantitative RT–PCR ( CAMK2D ), respectively. Data are derived from three separate experiments with three technical replicates (individual RNA preparations) in each group. Differences between each individual experimental group and the control group were assessed with Student’s t -tests, * P < 0.05, ** P < 0.01, *** P < 0.001. ( G ) Enrichment of CACNA1C , LMO7 , and CAMK2D in GFP-RBM20 RIP RNA from iPS-CM transfected with si276-Ex1 or siScr, analysed with qRT–PCR. Analysis of unrelated GAPDH RNA was included as a negative control. Data are derived from two separate experiments.

    Article Snippet: For knockdown experiments, cells were transfected with Silencer Select siRNA (ThermoFisher) directed towards exon 1 (si276-Ex1, #n294437) or exon 12 (si276-Ex12, custom design ID #ABRSBMG) of TTN-AS1-276, towards RBM20 (ENST00000369519.4, #s49081) or with a scrambled negative control siRNA sequence (#4390843).

    Techniques: Transfection, Negative Control, Derivative Assay, Expressing, Quantitative RT-PCR, Control

    Downregulation of KAT6A/B mRNAs and protein expression by siRNA-induced knock-down in breast cancer cell lines MCF-7 and MDA-MB-231. Quantitative polymerase chain reaction was used to analyze KAT6A, KAT6B and ERα mRNA expression in MCF-7 cell line ( A ) and KAT6A and KAT6B in MDA-MB-231 cell line ( B ). Western blot analysis ( F ) measured the effects of siRNA-mediated knockdown of KAT6A, KAT6B and ER in MCF-7 ( C ) and KAT6A/B in MDA-MB-231 ( D ) cell lines. GAPDH was used as an internal control ( E ). Data represent the mean and standard deviation of three independent experiments. Comparisons between groups were done using Student’s t-test: * p < 0.1; ** p < 0.01; *** p < 0.001; **** p < 0.0001. Source data are provided as a Supplementary S1.

    Journal: Scientific Reports

    Article Title: ERα status of invasive ductal breast carcinoma as a result of regulatory interactions between lysine deacetylases KAT6A and KAT6B

    doi: 10.1038/s41598-024-78432-0

    Figure Lengend Snippet: Downregulation of KAT6A/B mRNAs and protein expression by siRNA-induced knock-down in breast cancer cell lines MCF-7 and MDA-MB-231. Quantitative polymerase chain reaction was used to analyze KAT6A, KAT6B and ERα mRNA expression in MCF-7 cell line ( A ) and KAT6A and KAT6B in MDA-MB-231 cell line ( B ). Western blot analysis ( F ) measured the effects of siRNA-mediated knockdown of KAT6A, KAT6B and ER in MCF-7 ( C ) and KAT6A/B in MDA-MB-231 ( D ) cell lines. GAPDH was used as an internal control ( E ). Data represent the mean and standard deviation of three independent experiments. Comparisons between groups were done using Student’s t-test: * p < 0.1; ** p < 0.01; *** p < 0.001; **** p < 0.0001. Source data are provided as a Supplementary S1.

    Article Snippet: Ambion predesigned siRNAs, including GAPDH siRNA as a positive control and scrambled sequence siRNA as a negative control, were used in the experiments.

    Techniques: Expressing, Knockdown, Real-time Polymerase Chain Reaction, Western Blot, Control, Standard Deviation

    Journal: iScience

    Article Title: Altering heparan sulfate suppresses cell abnormalities and neuron loss in Drosophila presenilin model of Alzheimer Disease

    doi: 10.1016/j.isci.2024.110256

    Figure Lengend Snippet:

    Article Snippet: Lentivirus Negative Scramble shRNA Target Sequence: GCACTACCAGAGCTAACTCAGATAGTACT , Origene , Cat#TR30021.

    Techniques: Virus, shRNA, Sequencing, Recombinant, Staining, Synthesized, Transfection, Software, RNA Sequencing Assay

    Hydroxyapatite induced cytosolic CTSB contributed to NLRP3 inflammasome activation and caused chondrocyte pyroptosis. A) The Western blot result and quantitative analysis of Cathepsin B (CTSB) protein level of chondrocytes after transfected with siRNA targeting CTSB (si-CTSB). B) NLRP3, Caspase1 p20 and N-GSDMD protein levels of chondrocytes after the designated treatment, as determined by Western blot. C) Immunofluorescence staining of CTSB protein in chondrocytes of different groups. Scale bar: 10 μm. D) Fluorescence co-staining of propidium iodide (PI) and Hoechst 33342 in chondrocytes of different groups. Scale bar: 100 μm. E) Quantitative analysis of the fluorescence intensity of CTSB protein in (C) (n = 3). F–H) Quantitative analysis of NLRP3, Caspase1 p20 and N-GSDMD protein levels in (B) (n = 3). I-J) Quantitative analysis of IL-1β and lactate dehydrogenase (LDH) levels in chondrocyte culture supernatants of different groups (n = 3). K) Quantitative analysis of the percentage of PI-positive chondrocytes in (D) (n = 3). L) Cytosolic CTSB protein level and total NLRP3, Caspase1 p20, N-GSDMD, collagen II and aggrecan protein levels of chondrocytes after the designated treatment, as determined by Western blot. M) Fluorescence co-staining of PI and Hoechst 33342 in chondrocytes of different groups. Scale bar: 100 μm. N ) Schematic depicting the mechanism whereby hydroxyapatite (HAp) triggered chondrocyte pyroptosis. Statistical analyses were performed using one-way ANOVA with Holm-Šidák multiple comparison tests. NS, no significance; *, P < 0.05; **, P < 0.01; ***, P < 0.001.

    Journal: Bioactive Materials

    Article Title: Lysosomal destabilization: A missing link between pathological calcification and osteoarthritis

    doi: 10.1016/j.bioactmat.2023.12.001

    Figure Lengend Snippet: Hydroxyapatite induced cytosolic CTSB contributed to NLRP3 inflammasome activation and caused chondrocyte pyroptosis. A) The Western blot result and quantitative analysis of Cathepsin B (CTSB) protein level of chondrocytes after transfected with siRNA targeting CTSB (si-CTSB). B) NLRP3, Caspase1 p20 and N-GSDMD protein levels of chondrocytes after the designated treatment, as determined by Western blot. C) Immunofluorescence staining of CTSB protein in chondrocytes of different groups. Scale bar: 10 μm. D) Fluorescence co-staining of propidium iodide (PI) and Hoechst 33342 in chondrocytes of different groups. Scale bar: 100 μm. E) Quantitative analysis of the fluorescence intensity of CTSB protein in (C) (n = 3). F–H) Quantitative analysis of NLRP3, Caspase1 p20 and N-GSDMD protein levels in (B) (n = 3). I-J) Quantitative analysis of IL-1β and lactate dehydrogenase (LDH) levels in chondrocyte culture supernatants of different groups (n = 3). K) Quantitative analysis of the percentage of PI-positive chondrocytes in (D) (n = 3). L) Cytosolic CTSB protein level and total NLRP3, Caspase1 p20, N-GSDMD, collagen II and aggrecan protein levels of chondrocytes after the designated treatment, as determined by Western blot. M) Fluorescence co-staining of PI and Hoechst 33342 in chondrocytes of different groups. Scale bar: 100 μm. N ) Schematic depicting the mechanism whereby hydroxyapatite (HAp) triggered chondrocyte pyroptosis. Statistical analyses were performed using one-way ANOVA with Holm-Šidák multiple comparison tests. NS, no significance; *, P < 0.05; **, P < 0.01; ***, P < 0.001.

    Article Snippet: As a control, cells were transfected with sequence scrambled siRNA negative control (si-NC, sc-37007, Santa Cruz).

    Techniques: Activation Assay, Western Blot, Transfection, Immunofluorescence, Staining, Fluorescence, Comparison